https://huggingface.co/InstaDeepAI/nucleotide-transformer-500m-human-ref with ONNX weights to be compatible with Transformers.js.

Usage (Transformers.js)

If you haven't already, you can install the Transformers.js JavaScript library from NPM using:

npm i @xenova/transformers

Example: Retrieve embeddings from a dummy DNA sequence.

import { pipeline } from '@xenova/transformers';

// Create feature extraction pipeline
const extractor = await pipeline('feature-extraction', 'Xenova/nucleotide-transformer-500m-human-ref', {
    quantized: false, // Set to true to use the 8-bit quantized model.
});

// Perform feature extraction
const sequences = ["ATTCCGATTCCGATTCCG", "ATTTCTCTCTCTCTCTGAGATCGATCGATCGAT"]
const output = await extractor(sequences, { pooling: 'mean' });
console.log(output)
// Tensor {
//   dims: [ 2, 1280 ],
//   type: 'float32',
//   data: Float32Array(2560) [ -0.4544594883918762, 0.33294573426246643, ... ],
//   size: 2560
// }

You can convert the output Tensor to a nested JavaScript array using .tolist():

console.log(output.tolist());
// [
//   [ -0.4544594883918762, 0.33294573426246643, -0.06337763369083405, ... ],
//   [ 0.05060688406229019, -0.21165050566196442, -0.32883304357528687, ... ]
// ]

Note: Having a separate repo for ONNX weights is intended to be a temporary solution until WebML gains more traction. If you would like to make your models web-ready, we recommend converting to ONNX using ๐Ÿค— Optimum and structuring your repo like this one (with ONNX weights located in a subfolder named onnx).

Downloads last month
11
Inference Providers NEW
This model isn't deployed by any Inference Provider. ๐Ÿ™‹ Ask for provider support

Model tree for Xenova/nucleotide-transformer-500m-human-ref

Quantized
(1)
this model